Расшифровка блок фбс: Расшифровка ФБС — правильный вариант

Содержание

главные преимущества и область использования в строительстве. Статья.

Аббревиатура ФБС расшифровывается как «фундаментный блок строительный». Это дает полное представление о сфере использования материала. Блок применяется для возведения фундаментов, рассчитан на работы с сильными вертикальными нагрузками.

В изготовлении используется бетон и армирующий каркас. Такая комбинация делает блок в разы прочнее.

Когда покупатель собирается приобрести материал для строительства фундамента, перед ним часто встает вопрос – почему стоит выбирать именно ФБС? Мы решили провести сравнение с другими вариантами представленных на рынке материалов.

Плотность как основный показатель качества

Одним из главных параметров при выборе материала для строительства стен и фундамента остается плотность материала. Чем она выше, тем прочнее будет постройка. С ростом показателя снижается и опасность появления трещин.

У ФБС параметр доходит до 2400 кг/м3 — это один из самых высоких показателей на рынке. Для сравнения, использование в создании блоков полистиролбетона, пенобетона и газобетона не дает плотность выше 400–600 кг/м3. У считающегося одним из самых прочных типов материалов, керамзитобетона, такой параметр держится на уровне 700–1200 кг/м3. Ближайшие конкуренты — глиняный кирпич и шлакоблок тоже не дотягивают по уровню плотности. У них она доходит до 2000 кг/м3.

Обратите внимание на морозостойкость

Использование в строительстве проверенного бетона, хорошо приспособленного для условий отечественного климата, позволяет достичь показателей морозостойкости равных F200. Для строительного материала это очень внушительный параметр. Он указывает на то, сколько циклов замораживания и оттаивания способен выдерживать материал без потери прочности. ФБС выдерживают до 200 таких циклов. А теперь просто посмотрим на показатели конкурентов:

  • газобетон — 100;
  • пенобетон — 25;
  • полистиролбетон — 25–50;
  • керамзитобетон — 50;
  • шлакоблоки — 15–35;
  • строительный кирпич 15–20.

Нехитрая арифметика показывает, что из всех конкурентов блоки ФБС оказываются, как минимум, в два раза долговечнее. Если же сравнивать с морозостойкостью шлакоблоков или популярного и дорогого строительного кирпича, такие бетонные блоки выиграют еще больше позиций.

Меньше материала — выше экономия

Немаловажным аспектом являются и размеры блоков. Это один из самых крупных по габаритам материалов, представленных на рынке. Там, где хватает одного ФБС, нужно было бы использовать до 8 кирпичей — вы и сами понимаете, какую экономию времени это дает.

То же можно сказать и о других материалах. Строительство из блоков ведется в разы быстрее и помогает достичь лучших результатов.

Другие достоинства

Во многом характеристики блоков зависят от использованного в них бетона. Порекомендуем вам сразу проконсультироваться со строителями и выбрать материал, больше всего подходящий под ваш тип задачи.

Нам остается только перечислить другие, не менее важные достоинства ФБС. Среди них:

  • Продолжительный срок эксплуатации. Прослужит такой материал не меньше 150 лет.
  • Быстрое строительство с меньшими затратами сил.
  • Высокая прочность фундамента и стен.
  • Небольшой вес. Если вы используете бетонные блоки для строительства стен, это снижает нагрузку на фундамент
  • Высокая теплоизоляция. Достигается благодаря укладке на клей, а не на раствор. Шов между блоками намного меньше, чем между кирпичами. Отсюда получаем теплоизоляцию в 2–3 раза лучше, чем у кирпичных стен
  • Хорошая изоляция звука. Вы не будете слышать звуков до 50–79 дБ.

Остается прибавить сюда высокую жаропрочность, стойкость к биологическому воздействию и показатель водонепроницаемости равный W2, чтобы понять, почему материал такой востребованный в строительстве. Качественные фундаментные блоки — это тот материал строительства, который обеспечит устойчивость зданию долгие годы. Проверено на практике.

смотрите

ТАКЖЕ

Бетонные блоки фбс для фундамента — расшифровка наименований, размеры и вес

В данной статье рассматриваются особенности производства и маркировки блоков фундаментных железобетонных необходимых при возведении фундамента.

Блоки фундаментные железобетонные представляют собой крупногабаритные сплошные конструктивные элементы из монолитного бетона. Их используют при возведении фундамента построек жилого и нежилого вида. 

Они отличаются типоразмерами. Компания «ЖБИ Эксперт» предлагает вам купить блоки ФБС от проверенных отечественных производителей.

Сфера применения:

Блоки ФБС обладают повышенными техническими характеристиками и отличаются универсальностью. Их используют в гражданском, промышленном и других видах строительства.

Сплошные ж/б конструкции используют при возведении стен подвалов, а также различных объектов:

  • жилых домов до 4-х этажей;
  • дач;
  • сараев;
  • бань;
  • теплиц;
  • беседок.

В случае соблюдения всех правил обустройства ленточного фундамента частного дома и проведения гидроизоляционных работ блоки железобетонные по качественным характеристикам не будут уступать монолитному основанию.

Особенности маркировки:

Ж/б конструкции для фундаментов имеют маркировку. При выборе конкретной модели важно учитывать типоразмеры, вид бетона и блока.

Маркировка состоит из следующих показателей:

  • трех букв, определяющих тип блока, например, ФБС расшифровывается как фундаментный блок сплошной, ФБП – пустотный, ФБВ – с вырезом;
  • числа, определяющего округленную длину блока в дециметрах;
  • цифр, говорящих о ширине и высоте конструкции в дециметрах;
  • буквы, определяющей вид бетона, например, Т – тяжелый, С – плотный силикатный, П – керамзитобетон (на пористых заполнителях).

Чтобы вам было легче разобраться в маркировке, рассмотрим следующий пример:

ФБС 12.6.6-Т

ФБС – фундаментный блок сплошной;

12 – округленный показатель длины в дециметрах;

6 – округленная величина ширины в дециметрах;

6 – округленный показатель высоты в дециметрах;

Т — тяжелый вид бетона.

Технология производства:

Технологический процесс ЖБИ состоит из следующих этапов:

1)    Заливка бетона в специальные разборные металлические формы, стенки которых предварительно смазывают во избежание прилипания раствора.

2)    Уплотнение бетонного раствора погружными вибраторами.

3)    Установка в незастывшем составе петель для транспортировки.

4)    После появления первичной твердости разбор формы и окончательная просушка ж/б изделия.

Сплошные конструкции изготавливают немного иначе: они не имеют усиления в виде дополнительных металлических элементов, а состоят из монолитного бетона.

При изготовлении ФБС блоков фундаментных важно соблюдать ГОСТ. В стандартах прописано количество добавляемого бетонного раствора, время просушки, особенности изготовления блоков из тяжелого, силикатного или керамзитного бетона.

Особое внимание нужно уделять качеству бетонного раствора. От него зависят будущие технические и эксплуатационные характеристики конструкций.

Если вы нашли низкую цену на блоки ФБС, то будьте осторожней. В последние годы увеличилось количество кустарного производства. Такие модели можно использовать только при осуществлении ремонтных работ на дорогах, прокладке коммуникаций. Если речь идет о частном домостроении, то в целях безопасности лучше купить ЖБИ заводского производства с паспортом.

Компания «ЖБИ Эксперт» предлагает вам сплошные фундаментные конструкции высокого качества. Мы сотрудничаем с надежными заводами-изготовителями, которые при производстве придерживаются стандартов ГОСТ.

Изделия от «ЖБИ Эксперт» подойдут для строительства малоэтажных жилых домов и других объектов. Они выдерживают все виды негативного воздействия:

  • химическое;
  • биологическое;
  • механическое;
  • влагу;
  • температурные перепады;
  • мороз;
  • агрессивные среды.

Конструкции обладают отличными прочностными характеристиками, долгим эксплуатационным периодом (более 50 лет).

При заказе модели учитывайте размеры блоков ФБС, особенности проекта будущей постройки. Разнообразие нашего ассортимента позволит вам выбрать подходящий вариант для всех видов строительных работ.

Мы осуществляем доставку блока ФБС в Москве и ЦФО. На формирование стоимости в нашей компании влияет транспортировка – она занимает до 50%, так как речь идет о крупногабаритном грузе. Вес блоков ФБС указан в каталоге на нашем сайте. Мы гарантируем вам доступную цену без потери качества товара, так как сотрудничаем с лучшими производителями в Центральном федеральном округе и поддерживаем грамотную логистику.

Блоки ФБС — расшифровка, вес, фото, характеристики

Блоки ФБС расшифровка, вес, фото, характеристики.

Как правильно выбрать фундамент для конструкции и что такое ФБС в строительстве? Этот вопрос волнует каждого застройщика, ведь качественное основание для помещения любого типа стоит немало денег и занимает значительную часть в общей смете. Но если сэкономить на фундаменте, то вся конструкция подвергается риску.

Как получить надежное основание для конструкции, но при этом сэкономить средства.

Блоки ФБС, фото которых размещены на нашем сайте это идеальный вариант для прочного и надежного фундамента.

Что такое ФБС в строительстве.

Блоки ФБС (расшифровка – фундаментные блоки сплошные) – это лучший вариант для таких конструкций, как коттеджи, гаражи, фермы и другие небольшие сооружения, которые не требуют значительных материальных и трудовых затрат.

Какими преимуществами обладают эти железобетонные изделия.

При использовании в строительстве блоков ФБС значительно сокращается срок работы. Это происходит благодаря тому, что эти изделия не нуждаются в выдержке, как например, монолитные ленточные фундаменты. Такие блоки идеально подойдут для строительства в теплые времена года. Больше не нужно ждать целый месяц, чтобы фундамент полностью высох.

Благодаря специальным присадкам, что добавляются при изготовлении изделия, блоки ФБС (расшифровка фундаментные блоки сплошные) обладают отличной морозостойкостью и устойчивостью к агрессивной среде, например, к резким перепадам температуры в течение суток.

Большой выбор моделей. Блоки изготавливаются на заводах, которые специализируются на производстве железобетонных конструкций. Создать такие блоки самостоятельно невозможно. Это связано с тем, что завод – изготовитель использует специальную технологию (вибропрессование), соблюдая все необходимые требования к конструкции.

Реализовать такой способ возможно только в заводских условиях. Производители предлагают огромный выбор блоков.

Огромный модельный ряд удовлетворит каждого покупателя, который ищет материалы, которые подойдут именно для его стройки в соответствии с проектом.

Несмотря на большое количество преимуществ, необходимо помнить, что для укладки таких изделий вам понадобится спецтехника, потому что ФБС, вес имеет очень приличный.

Размеры ФБС.

Габариты ФБС (расшифровка – фундаментные блоки сплошные) закрепляют государственные нормативные документы. ГОСТ устанавливает длину, ширину, высоту, ФБС вес, а также допустимые отклонения от указанных величин.

Кроме стандартных габаритов, заводы изготавливают изделия по стандартам разных отраслей. Это позволяет строить фундаменты для различных помещений, несмотря на их размеры.

Монтаж и устройство блоков ФБС.

Блоки ФБС нельзя устанавливать на грунт по той причине, что их невозможно будет выровнять относительно горизонтальной поверхности. Существует два варианта. Первый – это тщательно выровненный песок, на который укладывается сетка.

Второй вариант – это монолитная бетонная подушка, что напоминает не очень высокий ленточный фундамент.

Для того чтобы сделать такую подушку, вам понадобится опалубка, арматура, проволока, цемент, песок, щебень. Раствор для подушки делают с помощью строительного миксера. Такая подушка высыхает на протяжении одной недели, после чего делается основная работа по укладке блоков. Обращаем ваше внимание и на то, что для установки блоков ФБС необходимо вырыть котлован, а не траншею.

Блоки такого типа соединяются между собой цементным раствором, который готовится непосредственно перед работой. Для прочности и устойчивости фундамента, специалисты рекомендуют дополнительно использовать арматуру, которая укладывается между блоками, и заливается раствором. Следите за тем, чтобы не было много воды в цементном растворе.

Укладка блоков ФБС напоминает обычную кладку из кирпича. Разница в том, что эти изделия имеют большой вес, а в процессе работы необходимо использовать специальную технику. Тщательно следите за отклонением ряда, а именно, чтобы оно не превышало допустимую норму, установленную ГОСТами.

Блоки укладываются так, чтобы верхнее изделие покрывало шов между двумя нижними.

Следует обратить внимание и на швы между блоками, которые обязательно необходимо защитить от вредных воздействий окружающей среды с помощью материала для гидроизоляции. Также необходима теплоизоляция, потому что через швы выходит все тепло, а в середину просачивается холодный воздух. Если соблюдать все рекомендации, то здание станет прочным и долговечным.

Если вы планируете построить гараж или другую конструкцию, то информация о том, как правильно выбрать материал для фундамента и блоки ФБС, фото на нашем сайте станут вам весьма полезными.

Алексей Молчанов, г. Пенза.

Еще по этой теме на нашем сайте.

Кабель ПВС расшифровка и основные параметры.

Кабель ПВС, расшифровка которого звучит как «соединительный провод в ПВХ оболочке», по своей конструкции ничем не отличается от аналогичных изделий. К основным характеристикам кабеля относится.

Кабель ВВГ расшифровка и основные характеристики.

Для передачи электроэнергии внутри зданий и сооружений, для освещения и обеспечения работы различного оборудования используется кабель ВВГ, расшифровка которого указывает на то, что медные жилы.

Провод ПВС расшифровка и технические характеристики.

Провод ПВС, расшифровка которого звучит как «провод в виниловой оболочке соединительный», применяется для передачи электроэнергии в производственных и бытовых условиях.

Кабель ПУГНП расшифровка и технические характеристики.

Провод ПУГНП, расшифровка аббревиатуры которого звучит как «провод универсальный гибкий плоский», широко применяется электриками. Выпускается провод в двух вариантах: двухжильном и трехжильном. Независимо от того.

Добавить комментарий Отменить ответ.

24.06.2017

Фундаментные блоки стен подвалов (ФБС, ФБП, ФБВ)

1. Как подразделяются фундаментные подвалов блоки на типы

2. Как расшифровать условные обозначения в маркировке фундаментных блоков?

3. Какие бетоны используются для производства фундаментных блоков
сплошных (ФБС)?

4. Где применяются фундаментные блоки пустотные? Как расшифровывается условное обозначение фундаментных пустотных блоков (ФБП)?

5. Где применяются фундаментные блоки с вырезом? Как расшифровывается условное обозначение фундаментных блоков с вырезом (ФБВ)?

6. Правила нанесения маркировочных знаков на фундаментные блоки. Какие показатели должны содержаться в основных надписях?

7. Как правильно транспортировать, складировать и хранить фундаментные блоки?

Как подразделяются фундаментные блоки подвалов на типы?

Ответ: Фундаментные блоки для стен подвалов согласно ГОСТ 13579-78 подразделяются на три типа:

ФБС – фундаментные блоки сплошные;

ФБП – фундаментные блоки пустотные с открытыми вниз пустотами;

ФБВ – фундаментные блоки сплошные с вырезом для укладки перемычек и пропуска коммуникаций

Как расшифровать условные обозначения в маркировке фундаментных блоков?

Ответ: Условные обозначения фундаментных блоков состоит из буквенных и цифровых значений:

-Первая группа – тип фундаментного блока;

-Втора группа – геометрические размеры;

-Третья группа – вид бетона, «Т» -тяжелый, «П» — на пористых заполнителях; «С» — силикатный.

Пример условного обозначения:

ФБС 24.4.6 -Т ГОСТ 13579-78 – фундаментный блок сплошной, длиной 2380 мм, шириной 400 мм и высотой 580 мм, из тяжелого бетона, выполнен по

ГОСТ 13579-78



Наименование

Высота, мм

Длина, мм

Ширина, мм

Эскиз

ФБС 24.4.6-Т



580

2400

400

Какие бетоны используются для производства фундаментных блоков сплошных (ФБС)?

Ответ: Фундаментные блоки сплошные (ФБС) изготовляют из тяжелого бетона и плотного силикатного бетона плотностью не менее 1800 кг/м3

Для производства (ФБС) применяется класс бетона B-7,5(100), 12,5 (150) и 15 (200), в зависимости от условий эксплуатации: влажность, перепады температуры.

Где применяются фундаментные блоки пустотные? Как расшифровывается условное обозначение фундаментных пустотных блоков (ФБП)?

Ответ: Фундаментные блоки пустотные (ФБП) применяются при строительстве ленточных фундаментов, стен подвалов, подпорных стенок, фундаментов под промышленное оборудование. Для производства ФБП применяется класс бетона 200, по морозостойкости F50.

Для армирования ФБП применяется сталь А-I; A-III; Вр-I.

Условные обозначения фундаментных пустотных блоков состоит из буквенных и цифровых значений:

-Первая группа – тип фундаментного блока;

-Втора группа – геометрические размеры;

-Третья группа – вид бетона, «Т» -тяжелый, «П» — на пористых заполнителях; «С» — силикатный.

Пример условного обозначения фундаментных пустотных блоков:

ФБП24. 5.6 -С ГОСТ 13579-78 – фундаментный пустотный блок, длиной 2380 мм, шириной 500 мм и высотой 580 мм, из плотного силикатного бетона, выполнен согласно ГОСТ 13579-78



Наименование

Длина, мм

Ширина, мм

Высота, м

Эскиз

ФБП 24.5.6-С



2380

500

580

Где применяются фундаментные блоки с вырезом? Как расшифровывается условное обозначение фундаментных блоков с вырезом (ФБВ)?

Ответ: Фундаментные блоки ФБВ чаще всего делаются под заказ, под конкретный проект. Заводы железобетонных конструкций серийно такие блоки не выпускают. Вырез в блоках рассчитывается под размещения труб, кабелей и других инженерных элементов.

Для производства ФБВ применяется класс бетона 200, по морозостойкости F50.

Для армирования ФБВ применяется сталь А-I; A-III; Вр-I.

Условные обозначения фундаментных пустотных блоков состоит из буквенных и цифровых значений:

-Первая группа – тип фундаментного блока;

-Втора группа – геометрические размеры;

-Третья группа – вид бетона, «Т» -тяжелый, «П» — на пористых заполнителях;

«С» — силикатный.

Пример условного обозначения фундаментных пустотных блоков:

ФБВ9.4.6-Т ГОСТ 13579-78 – фундаментный блок с вырезом, длиной 880 мм, шириной 400 мм и высотой 580 мм, из легкого бетона, выполнен по ГОСТ 13579-78



Наименование

Длина, мм

Ширина, мм

Высота, мм

Эскиз

ФБB9. 4.6-Т


880

400

580

Правила нанесения маркировочных знаков на фундаментные блоки. Какие показатели должны содержаться в основных надписях?

Ответ: Маркировочные надписи должны соответствовать требованиям ГОСТ 13015.2. маркировочные надписи наносятся на боковую поверхность фундаментных блоков. Подразделяются маркировочные надписи на основные, информационные и монтажные.

Согласно ГОСТу, основные надписи должны содержать:

марку железобетонной конструкции;

наименование предприятия-изготовителя или зарегистрированный товарный знак изготовителя;

штамп технического контроля.

Информационные надписи на фундаментных блоках должны содержать:

дату изготовления продукции;

массу конструкции.

Монтажные знаки состоят из изображений. Указывающих на:

место строповки железобетонной конструкции;

верх конструкции;

место опирания конструкции;

установочные риски на конструкции

Как правильно транспортировать, складировать и хранить фундаментные блоки?

Ответ: При транспортировке и хранении фундаментных блоков каждое изделие должно устанавливаться на прокладки толщиной не менее 30 мм. прокладки под нижний ряд блоков должны быть сплошными как при транспортировке, так и при хранении.

Фундаментные блоки должны быть рассортированы по партиям и маркам и уложены вплотную друг другу. Высота штабеля согласно ГОСТ не должна превышать 2,5 метра.

При транспортировке фундаментные блоки должны быть надежно закреплены.

Погрузку и разгрузку блоков необходимо выполнять с помощью подъемного крана.

Ветры и температуры на высоте (FBs)

  • Прогнозы ветра и температуры наверху (FB) представляют собой подготовленные компьютером прогнозы для конкретных мест на прилегающей территории США и сети мест на Аляске и Гавайях, основанные на прогоне модели североамериканского мезомасштаба (NAM) [Рисунок 1]
  • «FDWinds», теперь «FBwinds», выпускаются как в текстовом, так и в графическом формате
  • Эта информация помогает пилоту:
    • Определение наиболее благоприятной высоты на основе ветра и направления полета
    • Выявление областей возможного обледенения воздушных судов путем регистрации температуры воздуха от +2°C до -20°C и температурных инверсий
    • Прогнозирование турбулентности путем наблюдения резких изменений направления и скорости ветра на разных высотах
  • Прогноз ветра и температуры на высоте состоит из двух основных элементов:
    • Уровни прогноза

    • Выдается для различных высот в зависимости от местоположения [Рисунок 4]
    • «FT» указывает уровни данных о ветре и температуре
    • Группа из четырех цифр показывает направление ветра в десятках градусов, две вторые — скорость ветра в узлах
    • Высоты до 15 000′, уровни являются истинной высотой (ссылки на MSL)
    • Высоты на уровне 18 000 футов или выше, уровни являются барометрическими высотами (ссылки на FL)
    • Символическая форма прогнозов DDff+TT, в которой:
      • DD – направление ветра
      • ff скорость ветра, а
      • ТТ температура
    • Уровни прогноза

      • Данные прогноза ветра и температуры на высоте

      • В пределах 1500 футов от отметки станции не прогнозируется ветра
      • Прогнозируется истинный ветер, указанный в десятках градусов (две цифры) относительно истинного севера, а скорость ветра указывается в узлах (две цифры)
      • Если прогнозируемая скорость менее 5 узлов, кодируется группа 9900, что означает «легкий и переменный».
        • 9
        • : ветер легкий и переменный, температура 12°C

      • Если прогнозируемая скорость превышает 100 узлов, из скорости ветра вычитается 100, а к направлению ветра добавляется 50.
        • 731960:
          • Шаг 1: 73-50 = 23 или 230
          • Шаг 2: 19 + 100 = 119
          • Результат: [email protected] (температура -60°C)
      • Если прогнозируется скорость ветра 200 узлов или более, группа ветра кодируется как 99 узлов.
      • Температуры не прогнозируются в пределах 2500 футов над уровнем моря от отметки станции
      • В столбце 3000 футов температуры не прогнозируются
      • Группа из шести цифр включает прогноз температуры в градусах Цельсия.
        • 192832: последние две цифры показывают 32°C для температуры, но помните, что выше 24 000′ отрицательный знак исключается
  • Данные прогноза ветра и температуры на высоте


Copyright © 2022 CFI Notebook. Все права защищены.| Политика конфиденциальности | Условия обслуживания | Карта сайта | Патреон | Контакт

Расшифровка неканонического распада мРНК сенсором стресса эндоплазматического ретикулума IRE1α

Клеточная культура и экспериментальные реагенты

Клетки MDA-MB-231, HCC1806, KMS-27, HCT116 и AMO-1 были получены из ATCC. Клетки U2OS WT и IRE1α KO описаны Belyy et al. 54 . Все клетки были аутентифицированы с помощью профилей коротких тандемных повторов (STR) и протестированы на отсутствие микоплазмы в течение 3 месяцев использования.Все клеточные линии культивировали в среде RPMI1640 с добавлением 10% (об./об.) эмбриональной бычьей сыворотки (FBS, Sigma), 2 мМ глутаМАКСа (Gibco) и 100 ЕД/мл пенициллина плюс 100 мкг/мл стрептомицина (Gibco).

Тапсигаргин (Sigma) использовали в концентрации 100 нМ. Соединение 4µ8C и соединение 18 растворяли в ДМСО для клеточных экспериментов и использовали в указанных концентрациях. Антитела (Ab) к IRE1α (#3294), TGOLN2 (#95649), AIM2 (#12948), актину (#5125) и GAPDH (#8884) от Cell Signaling Technology. CD59 (#133707), GBA (#125065), BCAM (#134110), HIP1 (#181238), TLR2 (#68159), SIX2 (#111827), SUOX (#129094) и BMP4 (#124715) от Abcam . BLOC1S1 (#19687-1-AP), OAS2 (#19279-1-AP), ALDh2A3 (#25167-1-AP), GPC1 (#16700-1-AP) от ProteinTech. Антитела pIRE1 и XBP1s были получены в Genentech. Вторичные антитела (кроличьи № 711-035-152 и мышиные № 715-035-150) были получены от Jackson ImmunoResearch Laboratories.

Нокаут CRISPR/Cas9: направляющие последовательности РНК и методика IRE1, нацеленный на гРНК (см. ниже), клонирован в вектор pLKO.Трансфекцию проводили с использованием Lipofectamine 3000 в соответствии с протоколом производителя, а трансформанты отбирали с помощью ПЦР на геномной ДНК для обнаружения делеций. Затем секвенировали правильные клоны.

IRE1 α KO cl.1-2 пара гРНК: CTTGTTGTTTGTGTCAACGC & TCTGCTTCCAAGCGTATAC.

RNAseq/GROseq

И RNAseq, и GROseq проводили на клетках WT и IRE1 α KO MDA-MB-231. Для каждой RNAseq и GROseq было четыре экспериментальных условия (WT и IRE1 α KO, обработка Tg или контрольным носителем (ДМСО) в течение 8 часов с тремя биологическими повторами ( n  = 3) для каждого условия.

Для RNAseq РНК экстрагировали с использованием набора RNeasy (Qiagen #74104), выполняя расщепление ДНК на колонке в течение 15 мин. Концентрацию образцов РНК определяли с использованием NanoDrop 8000 (Thermo Scientific), а целостность РНК анализировали с помощью анализатора фрагментов (Advanced Analytical Technologies). Приблизительно 500 нг общей РНК использовали в качестве исходных данных для подготовки библиотеки с использованием набора для подготовки образцов РНК TruSeq v2 (Illumina).

Для GROseq клетки предварительно обрабатывали 5-этинилуридином (EU) в течение 30  мин перед фракционированием ядер с использованием набора Sigma (#NUC101), а затем с помощью протокола Invitrogen Click-iT™ Nascent RNA Capture Kit для экстракции растущего транскрипта (# C10365).Затем РНК экстрагировали с использованием набора RNeasy (Qiagen #74104), выполняя расщепление ДНК на колонке в течение 15 минут, а затем подвергали обратной транскрипции с помощью Superscript VILO IV Master Mix от Invitrogen. Библиотеки готовили в соответствии с протоколом из набора для подготовки библиотеки РНК NEBNext® Ultra™ II для Illumina® (NEB #E7770S) и указателей (NEB #E7335S и #E7500S).

Размер библиотек для RNAseq и GROseq был подтвержден с помощью 4200 TapeStation и ленты для скрининга High Sensitivity D1K (Agilent Technologies), а их концентрация была определена методом количественной ПЦР с использованием набора для количественного определения библиотеки (KAPA).Библиотеки мультиплексировали, а затем секвенировали на Illumina HiSeq2500 (Illumina) для получения 30 M ридов с одним концом из 50 пар оснований.

Комбинированный анализ RNAseq-GROseq

Функция DGEList из пакета edgeR (версия 3.24.3) в R (версия 3.5.1) была применена к подсчетам из наборов данных GRO-seq и RNA-seq, объединенных в один набор данных . Гены сохраняли, если их количество на миллион превышало 1,0 не менее чем в трех образцах, и к полученной матрице количества применяли функцию calcNormFactors.Отрицательные биномиальные дисперсии вычислялись с использованием функции AssessmentDisp с параметром устойчивости, установленным в значение true. Наблюдения были логарифмически преобразованы и взвешены с использованием функции voomWithQualityWeights из пакета limma (версия 3.38.3) в R. Статистические данные были рассчитаны с использованием функций lmFit, converts.fit и eBayes для контраста между выражением GRO-seq диких образцы типа, обработанные Tg через 8 часов по сравнению с ДМСО, минус экспрессия РНК-seq образцов дикого типа, обработанных Tg через 8 часов по сравнению с ДМСО.

Чтобы идентифицировать IRE1α-специфические RIDD-мишени, мы сравнили дифференциальную экспрессию генов в клетках WT и KO после 8-часовой обработки Tg: Log 2 кратное изменение (Log 2 (FC)), средняя экспрессия, p — значения и значения частоты ложных открытий (FDR) были рассчитаны для каждого белка, кодирующего гены, сравнивая начальную временную точку ДМСО с 8 часами после обработки Tg в условиях WT и IRE1 α KO для обоих наборов данных RNAseq и GROseq. Log 2 (FC) в наборе данных RNAseq WT, для которого значение p и значение FDR были выше 0. 05 были удалены. Различие Log 2 (FC) между наборами данных RNAseq WT и IRE1 α KO (Log 2 (KO-WT)) ниже 0,5 было удалено, а также были удалены гены со средними значениями экспрессии ниже 1. Наконец, различия Log 2 (FC) между RNAseq и GROseq WT (Log 2 (WTrna-WTgro)), опускающиеся ниже -0,3, были удалены. Результирующий список генов состоит из 54 записей.

Анализ сигнальной последовательности

Для каждого транскрипта мРНК, выбранного в качестве репрезентативного кандидата для гена, мы определили соответствующую последовательность белка с помощью GMAP (версия 2019-12-01) 73 путем выравнивания последовательности с самой собой с помощью -g флаг и извлечение полноразмерной трансляции белка с флагами «-P-F».Затем мы запустили программу signalp (версия 3.0) 74 на последовательности белка с флагом «-t euk», что дало предсказание сигнальной последовательности и вероятности для сигнального пептида, сигнального якоря и сайта расщепления. Каждая мРНК также была проверена в Uniprot для дополнительной проверки.

Иммунофлуоресцентное окрашивание белков с РНК гибридизацией in situ (ISH) цитоспин

IRE1α Клетки WT и KO MDA-MB-231 готовили следующим образом: клетки выращивали на чашках диаметром 10 см, обрабатывали Tg (100 нМ) и собранные в моменты времени 0, 6 или 24 часа.Клетки подсчитывали с помощью ViaCell и ресуспендировали в PBS при 1 × 10 6 /мл. Затем клетки центрифугировали при 500 ×  g в течение 5 минут при комнатной температуре (КТ) и почти полностью удаляли PBS, не нарушая осадок. Осадки ресуспендировали путем осторожного пипетирования в соответствующий объем NBF (10% об./об. нейтрального забуференного формалина) для получения концентрации клеток 1 × 10 6 /мл и инкубировали в течение 30 мин при 37°С. Затем образцы центрифугировали при 500 ×  g в течение 5 минут при комнатной температуре, удаляли NBF и дважды промывали клетки в PBS.После последней промывки PBS клетки ресуспендировали в ледяном 70% растворе этанола в концентрации 1 × 10 6 /мл и хранили при 4 °C до использования для анализа (максимум 1 месяц). Образцы центрифугировали при 800 RCF в течение 10 мин и извлекали предметные стекла из набора для цитопрепа. Предметные стекла сушили на воздухе в течение 20 минут при комнатной температуре и обезвоживали в 50, 70 и 100% этаноле при подготовке к окрашиванию.

Автоматизированные процедуры

Автоматизированный цитоспиновый ISH — это модифицированный одиночный протокол ISH от Advanced Cell Diagnostics RNAScope 2.5 LS Reagent Kit-Red User Manual (ACD, UM-322150 RevA), выполненное с использованием системы Leica Bond-RX. Этапы предварительной обработки были скорректированы для поддержания оптимальной морфологии образцов цитоспина. Процедура флуоресцентного ISH была изменена по сравнению с протоколом ACD на этапах амплификации.

Предварительная обработка образцов

После цитоспинирования предметные стекла извлекали из 100% этанола и сушили в течение 30 мин в печи при 37 °C. Предметные стекла были помечены протоколом ACD2.5 Red Rev B (без этапа контрастного окрашивания) и помещены в лоток штатива для предметных стекол Bond RX для обработки. Выберите «замороженную задержку слайда» в качестве протокола подготовки, чтобы приспособиться к ночной задержке. Поиск антигена проводили с помощью *ACD HIER в течение 15 минут с ER2 при 88 °C (Bond Epitope Retrieval Solution 2; Leica Cat # AR9640). Стадия ферментативного расщепления была пропущена, чтобы избежать чрезмерного переваривания образца. Активность эндогенной пероксидазы подавляли перекисью водорода RNAScope 2,5 LS в течение 10 минут при комнатной температуре и дважды промывали промывочным буфером 1X Bond (концентрат Leica 10X, кат. № AR9590). Этап гашения перекисью был повторно добавлен в протокол гибридизации в качестве обходного пути, поскольку этапы ферментативной обработки и гашения были связаны в автоматизированной программе.Таким образом, отмена обработки ферментом также приводит к отмене стадии гашения. В этом обходном пути нет необходимости, если этап ферментативного расщепления не исключен.

Двойная флуоресцентная процедура ISH/ICC

Двойная флуоресцентная цитоспиновая процедура ISH/ICC (иммуноцитохимия) 75 322150). После предварительной обработки образца были выполнены этапы гибридизации и амплификации в соответствии с RNAScope LS2.5 (ACD, UM-322150 RevA) (см. Дополнительную таблицу 8). Зонды гибридизовали в течение 2 ч при 42°С. Предметные стекла промывали промывочным буфером 1X Bond (концентрат Leica 10X, AR9590) при 42 °C 3 раза (0, 1, 5 мин) с последующими восемью промывками промывочным буфером 1X Bond по 0 мин каждое. Образцы обрабатывали только до конца этапа Амплификации 4 (*ACD Amp4) с последующей промывкой. Обнаружение ISH было завершено с использованием Opal-570 (1: 1500) в 1-кратном буфере для амплификации (PerkinElmer, NEL794001KT) 1 и 10 минут каждый при комнатной температуре.Предметные стекла промывали промывочным раствором 1× Bond 3 раза по 0 мин каждый, а затем еще 5 раз по 1 мин при комнатной температуре. Затем предметные стекла дважды промывали деионизированной водой и продолжали процедуру ICC.

После завершения обнаружения ISH предметные стекла снова обрабатывали перекисью водорода RNAScope LS2. 5 для подавления эндогенной пероксидазы в течение 10 минут при комнатной температуре и три раза промывали промывочным буфером 1× Bond. Предметные стекла инкубировали с блокирующим TNB (0,1 М трис-HCl, рН 7,5, 0,15 М NaCl, 0,5% блокирующего реагента PerkinElmer, FP1012) в течение 30 мин при комнатной температуре.Первичное антитело инкубировали 60 мин при комнатной температуре. Затем предметные стекла промывали 3 раза открытым промывочным буфером 1× Bond. Конъюгированное с HRP вторичное антитело добавляли на 30 мин при комнатной температуре, а затем выполняли шесть открытых промывок промывочным раствором 1× Bond. Заключительный этап детекции проводили с красителем PerkinElmer Opal-690 (1:1500) в 1× буфере для амплификации, инкубировали в течение 30 мин при комнатной температуре. Избыток красителя удаляли восемью открытыми промывками промывочным раствором Bond. Спектральное контрастное окрашивание DAPI (PerkinElmer. FP1490) проводили в течение 5 минут при комнатной температуре.Избыток DAPI смывают пятью промывками деионизированной водой. Наконец, слайды были покрыты покровным стеклом с реагентом против выцветания Prolong Gold (Life Technology, номер по каталогу P36930) или с постоянной средой для монтажа Tissue Tek Mounting Medium (Sakura, номер по каталогу 6419) на основе ксилола.

RT-qPCR

РНК экстрагировали с использованием набора RNeasy Plus (Qiagen #74134). Равные количества РНК подвергали обратной транскрипции и амплифицировали с использованием набора TaqMan™ RNA-to-CT™ 1-Step Kit (Applied Biosystems № 4392938) на системе ПЦР в реальном времени ABI QuantStudio 7 Flex.Значения дельта-дельта C T рассчитывали путем соотнесения каждого отдельного значения C T с его внутренним контролем GAPDH. TaqMan праймеры для XBP1u (# Hs02856596_m1), XBP1s (# Hs03929085_g1), DGAT2 (# Hs01045913_m1), BLOC1S1 (# Hs00155241_m1), CD59 (# Hs00174141_m1) и TNFAIP8L1 (# Hs00537038_m1) и GAPDH (# Hs02758991_g1) были от технологии Life . Дополнительные пары праймеров, используемые для количественной ПЦР в экспериментах по спасению клеток, были заказаны в IDT: TNFAIP8L1 (#Hs. PT.58.39992641), SNN (#Hs.PT.58.28146300), SIX2 (# Hs.PT.58.40614621), GAPDH (# Hs.PT.39a.22214836) и специально разработанные (см. Дополнительную таблицу 9).

Конструкции РНК Т7

Мы подготовили транскрипты РНК Т7 из матриц кДНК, выбранных на основе функциональной значимости в сочетании с оптимальной длиной для рибонуклеолитической реакции (~ 0,5–2  т.п.н.). конструкции кДНК, кодирующие XBP1 (#HG10751-UT), DGAT2 (#HG14114-G), CD59 (#HG12474-UT), TGOLN2 (#HG17252-UT), SIX2 (#HG21116-UT), CFAP45 (#HG22377-UT) , MFAP2 (#HG16644-UT), PIGQ (#HG22757-UT), BMP4 (#HG10609-UT), BCAM (#HG10238-UT), SNN (#HG23279-U), GBA (#HG12038-UT), WT1 (#HG12282-UT), CCDC69 (#HG27177-U), AIM2(#HG11654-UT) были от Sino Biological, а BLOC1S1 (#RC224412), TNFAIP8L1 (#RC203912) от Origene.кДНК амплифицировали с использованием прямых праймеров T7 и затем транскрибировали in vitro с использованием набора для быстрого синтеза РНК HiScribe™ T7 Quick High Yield RNA Synthesis Kit от NEB (#E2050S).

Мутации РНК T7 были сконструированы с использованием перекрывающейся ПЦР с последующим рестрикционным расщеплением, а конечные фрагменты были очищены из агарозного геля (набор для восстановления ДНК Zymoclean Gel #D4001).

Очистка белков и разделение фосфорилированных фракций IRE1α

IRE1α KR 0P и 3P были произведены компанией Accelagen и собственными силами: IRE1α KR (G547-L977) был экспрессирован в виде N-концевых His 6 -меченных слитых белков в клетках SF9 с сайтом расщепления протеазы TEV из внутриклеточного вектора экспрессии BEVS.Осадок клеток ресуспендировали в лизирующем буфере, содержащем 50 мМ HEPES pH 8,0, 300 мМ NaCl, 10% глицерин, 1 мМ MgCl 2 , 1:1000 бензоназу, таблетки PI без ЭДТА (Roche), 1 мМ TCEP и 5 мМ. имидазол. Образец лизировали ультразвуком, центрифугировали при 12 000 ×  g в течение 45 минут, а супернатант фильтровали через фильтр Nalgene 0,8 мкм. Осветленный супернатант связывали с гранулами Ni-NTA Superflow (Qiagen) гравитационной фильтрацией. Гранулы промывали буфером для лизиса с добавлением 15 мМ имидазола с последующей элюцией белка в буфере для лизиса, содержащим 300 мМ имидазола.Элюат инкубировали с протеазой TEV в течение ночи при 4 °C. Образец белка IRE1α KR разводили 1:10 в 50 мМ HEPES pH 7,5, 50 мМ NaCl, 1 мМ TCEP, а затем загружали в предварительно заполненную колонку Q-HP объемом 5 мл (GE-Healthcare). Разделение нефосфорилированного и фосфорилированного IRE1α KR было достигнуто путем элюирования белка с очень небольшим градиентом (50-300 мМ NaCl при 70CV). Полностью фосфорилированную фракцию (MW + 240 по данным ЖХ-МС) собирали отдельно, а остальные белковые фракции объединяли и инкубировали с лямбда-фосфатазой в течение одного часа при комнатной температуре.Дефосфорилирование было подтверждено ЖХ-МС. Затем нефосфорилированные и фосфорилированные образцы концентрировали и загружали отдельно на колонку HiLoad 16/600 Superdex 200 SEC (GE Healthcare), уравновешенную 25 мМ HEPES, pH 7,5, 250 мМ NaCl, 1 мМ TCEP, 10% глицерина. IRE1α элюируется в виде мономера.

Мутанты S724A, S726A, S729A, S724A-S726A, S724A-S729A, S726A-S729A и R887A были получены собственными силами в соответствии с описанной выше процедурой.

Картирование сайтов фосфорилирования выполняли с помощью анализа ЖХ-МС/МС после расщепления протеазой (см. Дополнительную таблицу 10).

Фосфорилирование мутантов IRE1α KR и петли активации

Мутанты IRE1α KR S/A и R887A подвергались автофосфорилированию в присутствии 2 мМ АТФ и 10 мМ MgCl 2 в течение одного часа при комнатной температуре. Образец очищали от АДФ эксклюзионной хроматографией (SEC).

Мутант S726A-S729A не был способен к аутофосфорилированию и вместо этого был инкубирован с pIRE1α LKR (линкер-киназа-РНКаза, остатки Q470-L977) в соотношении 1:40 мас./мас., 2 мМ АТФ и 20 мМ MgCl 2 .Конечные фосфорилированные белки очищали от pIRE1α LKR и остаточных нуклеотидов с помощью SEC.

Анализ расщепления РНК

Один микрограмм РНК Т7 расщепляли при комнатной температуре с помощью 1 мкг рекомбинантного белка IRE1α KR человека (конечная концентрация ~0,8 мкМ) в течение 15 мин в буфере для расщепления РНК (HEPES pH 7,5, 20 мМ; K ацетат, 50 мМ). ; ацетат Mg 1  мМ; TritonX-100 0,05% (об./об.)). Общий объем реакции составляет 25 мкл. Затем расщепление дополняли равным объемом формамида и нагревали при 70 °С в течение 10 минут для линеаризации РНК.После линеаризации смесь сразу помещали на лед на 5 мин, а затем 20 мкл прогоняли в 3% агарозном геле при 160 В в течение 50 мин при 4°С. Если использовались ингибиторы (5 мкМ), их инкубировали с РНК в течение 40 минут на льду перед расщеплением РНК. Гели визуализировали на приборе BioRad Molecular Imager ChemiDoc ZRS+.

Секвенирование фрагментов РНК

Два микрограмма РНК T7 (TNFAIP8L1, DGAT2) используются для расщепления IRE1α KR-3P человека, как описано выше. Полосы РНК экстрагируют из геля с использованием набора Zymoclean Gel RNA Recovery Kit (Zymo Research #R1011).Затем выделенную РНК лигировали с помощью лигазы RtcB (NEB # M0458S) в олигонуклеотид 3′-адаптера, специально разработанный и заказанный в IDT (caagcagaagacggcatacgagatCGTGAT), следуя ручному протоколу. Затем лигированную РНК подвергали обратной транскрипции с использованием системы синтеза первой нити SuperScript™ IV (Invitrogen #180) и праймера, специфичного для 3′-адаптера (ATCACGatctcgtatgccg). Затем кДНК амплифицировали с использованием специфического прямого праймера DGAT2 (gggGCATGCATGAAGACCCTCATAGCCG) или TNFAIP8L1 (gggGCATGCATGGACACCTTCAGCACCAAG), содержащего сайт фермента рестрикции SphI, и обычного обратного праймера, содержащего сайт фермента рестрикции EcoRI (gggGAATTCATCACGatctcgtatgccg).Продукт ПЦР затем расщепляли с помощью SphI и EcoRI перед клонированием в вектор pGEM®-T Easy (Promega #A1360). Затем полученные плазмиды трансфицировали в компетентные клетки (Zymo Mix & Go! Competent Cells Zymo 10B #T3019), высевали на чашку диаметром 10 см и оставляли при 37°С на ночь. На следующий день отдельные колонии собирают и выращивают в течение ночи на 96-луночных планшетах, предназначенных для роста бактерий (Thomson Instrument Company #951657). Наконец, ДНК извлекают из отдельных лунок с помощью набора Zyppy-96 Well Plasmid Miniprep Kit (Zymo Research # D4042) и отправляют на секвенирование SANGER (см. Дополнительные данные 1).

Анализ активности РНКазы (кинетическая флуоресценция)

Меченый 5′-карбоксифлуоресцеином (FAM) и 3′-гасителем черных дыр (BHQ) мини-субстрат с одной стеблем и петлей, содержащий последовательность XBP1 (5’FAM-CAUGUCCGCAGGCGCAUG-3 ‘BHQ) использовали в качестве субстрата для расщепления с помощью IRE1α KR (G547-L977) в 20 мМ HEPES pH 7,5, 50 мМ ацетата калия, 1 мМ ацетата магния, 1 мМ дитиотреитола, 0,05% об. /об. TritonX-100. 10 нМ белка инкубировали с различными концентрациями РНК-субстрата (серия двукратных разведений от 3000 до 5.86 нМ). Расщепление РНК измеряли кинетически в течение часа при комнатной температуре по увеличению флуоресценции. Заключительную реакцию проводили в 20 мкл в 384-луночных планшетах. Образцы запускали в двух повторностях. Скорость реакции измеряли как наклон линейно возрастающего сигнала флуоресценции с течением времени в относительных единицах флуоресценции (ОЕФ)/с и наносили на график как функцию концентрации РНК-субстрата. Кинетика Михаэлиса-Ментен была подогнана с использованием Prism 1.7, а результирующие константы Vmax и Km были зарегистрированы.

Иммуноблот-анализ

Клетки лизировали в 1× RIPA-буфере (Millipore) с добавлением свежих ингибиторов протеазы и фосфатазы (Invitrogen #78440), очищали центрифугированием при 12000 ×  g в течение 15 мин и анализировали с помощью BCA мин. Термофишер Научный № 23227). Загружали равные количества белка, разделяли с помощью SDS-PAGE, электропереносили на нитроцеллюлозные мембраны с помощью системы iBLOT2 (Invitrogen) и блокировали в 5% растворе обезжиренного молока в течение 30 мин. Мембраны зондировали необходимыми антителами. Сигнал был обнаружен с использованием соответствующих вторичных антител, конъюгированных с пероксидазой хрена (HRP). Все первичные антитела использовали в разведении 1:000 и гибридизовали в течение ночи при 4 °C с последующей двухчасовой инкубацией со вторичными антителами, конъюгированными с пероксидазой хрена (HRP), в разведении 1:10000.

Анализ перекрестного связывания

In vitro: 1 мкг рекомбинантного белка IRE1-KR подвергали поперечному сшиванию в 25 мкл конечного объема буфера для расщепления РНК, содержащего 1 мкл дисукцинимидилсуберата (DSS, Thermo Fisher Scientific) сшивающего агента на 6.25 мМ (конечная концентрация 250 мкМ) в течение 1 ч на льду. Для экспериментов с повторяющимися соединениями-ингибиторами и активаторами, IRE1α KR и низкомолекулярным соединением (5 мкМ) сначала предварительно инкубировали вместе на льду в течение 40 минут. Реакцию гасили, используя 1 мкл 1 М раствора ТРИС с рН 7,5 в течение 15 мин на льду. Затем реакционную смесь разбавляли в 500 мкл буфера для расщепления РНК, и 13 мкл его использовали для анализа на геле SDS-PAGE (что соответствует ~ 25 мкг белка). к нитроцеллюлозным мембранам с помощью системы iBLOT2 (Invitrogen) и блокировали в 5% растворе обезжиренного молока.Наконец, его инкубировали в течение ночи при 4 °C с антителом IRE1α (Cell Signaling, #3294S) в разведении 1:1000 с последующей двухчасовой инкубацией со вторичными антителами, конъюгированными с пероксидазой хрена (HRP), в разведении 1:10000.

In vivo: клетки лизировали в 100 мкл 1% Triton X-100 в PBS с добавлением свежих ингибиторов протеазы и фосфатазы (Invitrogen #78440), инкубировали на льду в течение 10 мин и очищали центрифугированием при 12 000 ×  г в течение 15 мин. Семьдесят микролитров лизата сшивали 0.7 мкл сшивающего агента DSS (Thermo Fisher Scientific) (конечная концентрация 250 мкМ) на 1 ч при комнатной температуре. Реакцию гасили, используя 3,5 мкл 1 М раствора ТРИС с рН 7,5 в течение 15 мин при комнатной температуре. Концентрацию белка определяли с помощью анализа BCA, и по меньшей мере 25 мкг использовали для анализа на геле SDS-PAGE для вестерн-блоттинга.

Гель-фракционирование

Сто микрограммов IRE1-KR-3P сшивали с помощью DSS в течение 30 мин на льду. Затем реакционную смесь наносили на гель Invitrogen 4–16% NativePAGE при 4 °C в течение 4  часов при 100 В.Затем гель разрезали на куски в местах, соответствующих мономерным, димерным и олигомерным фракциям. Затем гелевые фракции помещали в 100 мкл буфера для расщепления РНК, содержащего 4 мкг транскрипта РНК Т7, для переваривания в течение ночи при 4°С. Наконец, использовали 10 мкл реакционной смеси и запускали ее на 3% агарозном геле для визуализации.

Спасение клеточного IRE1α

Клеточные линии MDA-MB-231 или HCC1806 shIRE1α трансфицировали 2  ​​т.п.н., управляемой промотором IRE1α – устойчивым к shIRE1α – меченым GFP/His IRE1α WT или мутантным R887A – устойчивым к неомицину конструктом, с использованием Mirus TransIT-X2 система доставки на шестилуночных планшетах. Через 24 часа клетки переносили в индивидуальные колбы Т75 на 4 дня. Среду меняли, и клетки отбирали с использованием генетицина в конечной концентрации 1,5 мг/мл в течение примерно 10 дней, затем FACS сортировали на GFP-положительные клетки.

Анализ жизнеспособности

В общей сложности 4000 клеток высевали в четырех повторностях на 96-луночные планшеты Corning либо со стандартным плоским прозрачным дном, либо с ULA (#7007). При высеве клетки обрабатывали конечной концентрацией доксициклина 0,4 мкг/мл (Clonetech) в общем объеме 200 мкл. Спустя семь дней из каждой чашки очень осторожно отбирали по 100 мкл среды, не повреждая сфероиды из чашки ULA.Затем жизнеспособность клеток оценивали с помощью CellTiter-Glo 3D, добавляя 100 мкл буфера (Promega #G9683) в каждую лунку и несколько раз пипетируя вверх и вниз, и измеряя в люминесцентном ридере (Envision; PerkinElmer). Данные, представленные как относительная жизнеспособность после обработки Dox, рассчитываются из средних значений четырех повторов образцов, где жизнеспособность клеток, обработанных Dox, делится на жизнеспособность необработанных клеток (отношение) и нормализуется к средней жизнеспособности 2D.

Анализ TCGA

Данные секвенирования РНК были взяты из 635 нормальных образцов и 6731 образца опухоли из 20 типов тканей в TCGA.Показатели RIDD и RIDDLE рассчитывали, взяв средний Z-показатель для сигнатурных генов. Показатели RIDD рассчитывали, взяв средний Z-показатель для генов: BLOC1S1 (Entrez Gene ID 2647), PIGQ (9091), TGOLN2 (10618), DGAT2 (84649), WT1 (7490), GBA (2629), CD59 ( 966) и BMP4 (652). Показатели RIDDLE рассчитывали, взяв средний Z-показатель для генов: BCAM (Entrez Gene ID 4059), CCDC69 (26112), MFAP2 (4237), SNN (8303), SIX2 (10736), AIM2 (9447), OAS2 ( 4939), CFAP45 (25790) и TNFAIP8L1 (126282).Данные о выживаемости для образцов TCGA были получены из архива GDC Legacy Национального института рака по адресу http://portal.gdc.cancer.gov/legacy-archive путем извлечения 225 файлов с клиническими данными в формате Biotab. Цензурированную справа общую выживаемость определяли из полей, помеченных как «days_to_death», «death_days_to», «days_to_last_followup», «last_contact_days_to» и «vital_status», и сопоставляли с данными РНК-seq по штрих-коду пациента, чтобы получить данные о выживаемости на 7283 ( 98,9\%) из 7366 образцов. Для каждого нормального и опухолевого типа заболевания пациенты были разделены на две примерно равные группы в зависимости от того, была ли их оценка по шкале RIDD или RIDDLE выше или ниже медианы для данного типа заболевания. Модель Кокса была подобрана с использованием функции coxph из пакета выживания (версия 2.44-1.1) в R (версия 3.5.1). P -значения были получены путем применения суммарной функции к модели Кокса. Кривые выживания были сгенерированы с использованием функции plot в R для объекта, созданного функцией survfit.Раковые опухоли, демонстрирующие значительно отличающуюся выживаемость ( p  < 0,01), были проиллюстрированы на рис. S6.

Статистика и воспроизводимость

Все значения представлены как средние (SEM) по крайней мере с двумя независимыми биологическими повторами и по крайней мере с двумя техническими повторами. Статистический анализ результатов проводили с помощью непарного двустороннего теста 90–130 t 90–131 или двустороннего дисперсионного анализа. Значение P ≤0,05 считалось значимым и обозначалось * P  ≤ 0.05; ** P  ≤ 0,01. Все статистические анализы проводились с использованием GraphPad Prism 9 (GraphPad Software, Inc.). Анализы расщепления РНК и вестерн-блоты были повторены независимо друг от друга не менее 3 раз с аналогичными результатами.

Сводка отчета

Дополнительная информация о дизайне исследования доступна в Кратком отчете об исследовании природы, связанном с этой статьей.

Фетальная бычья сыворотка One Shot (FBS) | Термо Фишер Сайентифик

Бутылка One Shot FBS 50 мл

Раствор без аликвот для сведения к минимуму контаминации и экономии времени.Флакон Gibco One Shot FBS 50 мл предназначен для значительного улучшения ваших результатов и решения бесчисленных проблем, замедляющих ваши исследования. Присоединяйтесь к aliquot-бесплатно

революция сегодня!

Заказать сейчас Запросить образец

В нашем флаконе One Shot FBS объемом 50 мл без аликвот можно получить раствор

80% исследователей аликвотируют свои FBS, и для этой задачи используется множество серологических пипеток и конических пробирок. Бутылка One Shot может помочь исследователям лучше использовать эти пластиковые изделия для более важной работы с клеточными культурами.

Все продукты One Shot FBS

Смотреть: Бутылка Gibco One Shot FBS 50 мл

Контролируйте свои результаты, положив конец аликвотированию

 Нажмите, чтобы увеличить изображение

Цитата исследователя

«Эта бутылка обеспечивает удобство и скорость при сохранении стерильности продукта. Поскольку у нас в лаборатории и за ее пределами много старшекурсников, это гарантирует, что одна неудача с не очень взрослыми руками не испортит целую пачку FBS. Бетани С. Пруднер, доктор философии , Лаборатория метаболической саркомы, Вашингтонский университет в Сент-Луисе

На этой странице:


Множество преимуществ One Shot FBS

Завершение аликвотирования

Разливая аликвоты FBS в конические пробирки объемом 50 мл, вы увеличиваете вероятность искажения результатов. Размер и конструкция флакона One Shot FBS объемом 50 мл устраняют этот шаг, позволяя вам контролировать свое время, риск загрязнения и постоянство объема.

Наливайте и пипетируйте с легкостью

Широкое горлышко бутылки и скошенный край обеспечивают плавное наливание без отрыжки. И, в отличие от текущего флакона One Shot, вы можете использовать пипетку на 25 и/или 50 мл. Куда бы вы ни пошли, вы доберетесь до последней капли.

Остановка цикла замораживания-оттаивания-повторения

Пропуск этапа аликвоты означает, что вам нужно только один раз заморозить, а затем разморозить FBS, что значительно экономит время и силы. А бутылки спроектированы таким образом, чтобы выдерживать замораживание, поэтому они не треснут и не лопнут крышки, как это часто бывает с коническими трубками.

Неудачная маркировка конца

Отсутствие номеров SKU или партий, сроков годности, происхождения или даже всей этикетки может вызвать цепную реакцию проблем. Бутылка One Shot имеет легко читаемую этикетку, поэтому вы точно знаете, что используете.

Освободите место в морозильной камере

Конструкция упаковки One Shot FBS оптимизирована для снижения нагрузки на емкость морозильной камеры.

Фактически, упаковка One Shot FBS 10 x 50 мл позволяет хранить на 35 л больше FBS в среднем на 20 футов.морозильной камере, чем наша нынешняя картонная упаковка One Shot 40 x 50 мл, и на 57 л больше, чем наша бутылка объемом 100 мл.

Упакуйте штатив

Ваши штативы больше не предназначены только для конических пробирок. Флакон One Shot FBS объемом 50 мл идеально подходит для большинства штативов для пробирок, включая прочные и долговечные штативы Nalgene Unwire Rack 30 мм. Таким образом, вы получаете удобную посадку в легко наливаемой, удобной для хранения бутылке без аликвоты.

Меньше отходов

Бутыль One Shot FBS на 50 мл образует на 33 % меньше отходов, чем аликвоты из бутылок на 500 мл (см. таблицу ниже).При использовании меньшего количества пластика потребляется меньше нефтяного сырья и выделяется меньше парниковых газов. В лаборатории типичный клиент, использующий 20 литров FBS в год, получит почти 7 часов и произведет на 7 фунтов меньше пластиковых отходов, выбрав One Shot FBS. Это является значительным преимуществом как для производительности лаборатории, так и для окружающей среды.

Метод Шаг в процедуре Пластик Требуется Вес (G) Вес (G) Общий пластиковый вес (G)
аликвота от 500 мл бутылки Оригинальный контейнер 1 х 500 мл бутылки 79.410 9040
аликвота в конические 2 1 х 25 мл серологический пипеткой 18.8 9040 9
10 Conical Trub 140.3 238,5

Один выстрел FBS 50 мл бутылки Оригинальный контейнер 10 x 50 ML бутылки 159. 0 159,0
33% отходов

33% отходов

Пара для лучшей производительности

Размер бутылки 50 мл идеально подходят для использования с 500-мл флаконами Gibco RPMI, DMEM или другими средами Gibco.Полное сопряжение носителей поможет максимизировать производительность и воспроизводимость.

По вопросам о характеристиках флакона One Shot FBS 50 мл обращайтесь в службу технической поддержки по адресу [email protected]

Доступен в одной бутылке 50 мл или в упаковке по 10 бутылок

Конфигурация коробки One Shot: 10 x 50 мл.

Информация для заказа

Один выстрел ФБС

Наши продукты FBS, которые чаще всего цитируются в мировых научных журналах, соответствуют вашим исследовательским потребностям и бюджетным требованиям.

A3160401, A3160402, A3160501, A3160502, A3160601, A3160602, A3160701, A3160702, A3160801, A3160802, A3160901, A3160902, A3161001, A3161002

Инактивированная нагреванием (HI) One Shot FBS

FBS нагревают в течение 30 минут в наших флаконах One Shot при 56 градусах Цельсия при перемешивании для инактивации комплемента.

A3840001,A3840002,A3840101,A3840102,A3840201,A3840202,A3840301,A3840302,A3840401,A3840402

Узнайте больше о наших продуктах HI на сайте 1f990/1therfisher.com.

Специальность One Shot FBS

Получите больший контроль над своими исследованиями с помощью нашей FBS, квалифицированной для специальных исследований и конкретных анализов.

A2720803,A3381901,A3382001,A3382101,10439001,16141002

Узнайте больше о наших специальных продуктах FBS на сайте thermofisher.com/specialtyfbs

Доступен в одной бутылке 50 мл или в упаковке из 10 бутылок

.

Только для исследовательских целей или дальнейшего использования в производстве. Белки сыворотки и крови не предназначены для прямого введения людям или животным.

Уровень сахара в крови натощак: нормальный, высокий и низкий + способы улучшения

Анализ уровня сахара в крови натощак — это один из способов проверки и мониторинга диабета.Как высокий, так и низкий уровень сахара в крови может быть опасным. Читайте дальше, чтобы узнать больше о тесте и причинах высокого или низкого уровня сахара в крови. Мы также рассмотрим лучшие стратегии снижения уровня сахара в крови для успешного предотвращения или лечения диабета.

Что такое анализ уровня сахара в крови натощак?

Процедура

Анализ уровня сахара в крови натощак также называется анализом уровня глюкозы в крови натощак. Он измеряет уровень сахара после голодания в течение не менее 8 часов.Глюкоза является основным сахаром, который содержится в крови, и ее высокий уровень после голодания может указывать на диабет.

Во время голодания перед тестом вы все равно можете пить воду (если иное не предписано врачом), но следует избегать кофе, чая, сока и газированных напитков. Медицинский работник возьмет кровь из вены на вашей руке, которая будет отправлена ​​в лабораторию для анализа [1].

После еды уровень глюкозы в крови обычно повышается в течение нескольких часов, поскольку вы расщепляете и усваиваете пищевые углеводы. У здоровых людей поджелудочная железа вырабатывает инсулин для перемещения глюкозы в ткани и из кровотока. Таким образом, уровень глюкозы будет постепенно снижаться после еды и оставаться низким во время голодания [2, 3].

Людям с диабетом либо не хватает инсулина для снижения уровня глюкозы в крови (диабет 1 типа), либо их организм не может эффективно использовать инсулин (диабет 2 типа). При измерении уровня глюкозы в крови натощак у диабетиков уровень сахара в крови будет намного выше, чем у людей без диабета, что в долгосрочной перспективе может привести ко многим проблемам со здоровьем [4, 1].

Анализ уровня сахара в крови натощак измеряет уровень глюкозы в крови после голодания в течение как минимум 8 часов. Высокий уровень может указывать на диабет.

Почему это назначают врачи

Анализ уровня глюкозы в крови натощак проводится для выявления преддиабета и диабета. Это также помогает врачам контролировать диабет и определять, влияют ли на него лекарства и диетические изменения [1].

Ваш уровень глюкозы в крови натощак является самым низким из возможных, поскольку влияние недавних приемов пищи сведено к минимуму [5, 6].

Уровень сахара в крови натощак часто измеряется вместе с HbA1c (также известным как гликированный гемоглобин), который является показателем уровня сахара в крови за последние три месяца. Чем больше сахара в крови, тем больше он будет присоединяться к гемоглобину, повышая уровень HbA1c [7].

Вместе они дают больше информации, чем каждый тест по отдельности. Например, даже если уровень сахара в вашей крови был очень высоким в какой-то случайный момент, за последние пару месяцев он мог быть в основном низким (низкий уровень HbA1c).С другой стороны, HBA1c может быть выше, но уровень глюкозы в данный момент ниже.

Помимо диабета, аномальные уровни могут указывать на такие проблемы, как резистентность к инсулину, гормональный дисбаланс, заболевания поджелудочной железы, печени или почек.

Врачи назначают анализ уровня сахара в крови натощак для скрининга и мониторинга диабета и преддиабета, обычно наряду с HbA1c.

Кто должен делать тест?

По данным Американской диабетической ассоциации, скрининг на диабет рекомендуется людям старше 45 лет (каждые 3 года) или в любом возрасте при наличии определенных факторов риска, включая [8]:

  • Избыточный вес, ожирение или физически неактивный
  • Наличие близкого родственника (первой или второй степени родства) с диабетом
  • Принадлежность к определенной расе/этнической группе (коренные американцы, афроамериканцы, латиноамериканцы, азиаты/жители островов южной части Тихого океана)
  • Наличие признаков резистентности к инсулину или состояния, связанные с резистентностью к инсулину, такие как высокое кровяное давление (гипертония), низкий уровень хорошего холестерина и/или высокий уровень триглицеридов (дислипидемия) и синдром поликистозных яичников
  • Диабет во время беременности (гестационный диабет)

Диапазоны уровня сахара в крови

Нормальный диапазон

Нормальный уровень глюкозы в крови натощак у здоровых людей составляет 70 – 125 мг/дл или 3 . 9 – 6,9 ммоль/л .

Низкий уровень сахара в крови или гипогликемия — это когда уровень сахара в крови падает ниже 70 мг/дл у диабетиков или около 55 мг/дл (3 ммоль/л) у здоровых людей.

Высокий уровень сахара в крови или гипергликемия — это когда уровень глюкозы в крови слишком высок, выше 126 мг/дл или 7 ммоль/л.

Нормальный уровень сахара в крови натощак у здоровых людей составляет 70–125 мг/дл.

Диапазон предиабета

Предиабет (также известный как нарушение уровня глюкозы натощак) относится к уровням глюкозы в крови, которые постоянно находятся на верхней границе нормального диапазона — между 100–125 мг/дл (5.6 – 7 ммоль/л). Предиабет опасен тем, что может легко перерасти в диабет [9].

Преддиабет означает, что у вас почти диабет, но не стоит отчаиваться. Предиабет обратим. Изменив образ жизни на ранней стадии, вы можете предотвратить диабет. Однако, если вы не вносите никаких изменений, исследования показывают, что вероятность того, что вы заболеете диабетом через четыре года, составляет около 40% [10].

Если уровень сахара в крови натощак составляет 100–125 мг/дл, возможно, у вас предиабет.

Преддиабетический диапазон

Уровни выше >126 мг/дл или >7 ммоль/л соответствуют диабетическому диапазону. По крайней мере, два значения в этом диапазоне в двух отдельных тестах необходимы вашему врачу для диагностики диабета.

Глюкометр

Возможность самостоятельно контролировать уровень глюкозы в крови очень важна, если у вас диабет. С помощью глюкометра вы можете регулярно проверять уровень сахара и соответствующим образом изменять свой образ жизни и питание. Счетчики позволяют отслеживать колебания, вызванные физическими упражнениями, едой, лекарствами, стрессом и другими факторами [11].

Вы можете выбрать из широкого спектра глюкометров с различной точностью. Счетчики с очень высокой точностью, как правило, стоят дороже. Некоторые измерители теперь могут быть интегрированы со смартфоном, а другие новые модели могут не требовать прокола пальца (некоторые можно вводить под кожу) или использовать крошечные и почти безболезненные иглы [11, 12].

Анализы уровня глюкозы в крови натощак и HbA1c более точны, но глюкометры просты в использовании, доступны и незаменимы для ежедневной проверки уровня сахара.

Обязательно приобретите точный глюкометр, чтобы регулярно контролировать уровень сахара, если у вас диабет.

Высокий уровень сахара в крови натощак

Для целей этой статьи мы будем рассматривать уровень сахара в крови в диапазоне предиабета и выше (>100 мг/дл или >5,6 ммоль/л) как высокий.

Причины

Причины, показанные ниже, обычно связаны с высоким уровнем глюкозы. Посоветуйтесь со своим врачом или другим медицинским работником, чтобы поставить точный диагноз.Ваш врач интерпретирует этот тест, принимая во внимание вашу историю болезни и результаты других анализов.

Хронические состояния, которые могут повышать уровень глюкозы натощак, включают:

  • Резистентность к инсулину [13, 14]
  • Ожирение [15, 16, 17, 18]
  • Сахарный диабет 1 и 2 типа [19, 4]
  • Беременность и гестационный диабет [19, 20]
  • Ожирение печени и другие заболевания печени [21, 22, 23]
  • Заболевания почек [24]
  • Повышенная активность щитовидной железы (гипертиреоз) [25]
  • Стресс вследствие болезни, травмы или операции [26, 27, 19]
  • Эндокринные расстройства, такие как синдром Кушинга (избыток кортизола), феохромоцитома (доброкачественные опухоли надпочечников), акромегалия (избыток гормона роста) [19, 28]
  • Воспаление поджелудочной железы (панкреатит) или рак [19]

Следующие факторы также повышают уровень сахара в крови:

  • Переедание [29]
  • Острый и хронический стресс [30, 31, 32]
  • Плохое качество сна или недостаточное количество сна [33, 34 , 35]
  • Курение [36, 37, 38] 9000 4
  • Загрязнение воздуха [39]
  • Хроническое воздействие токсинов, таких как полихлорированные бифенилы (ПХД) и хлорорганические пестициды (ХОП) [40]

Многие лекарства могут повышать уровень глюкозы, в том числе:

  • Антидепрессанты [41]
  • Препараты для лечения высокого кровяного давления, такие как тиазидные диуретики и бета-блокаторы [42, 42]
  • Эпинефрин/адреналин [43]
  • Эстроген и оральные контрацептивы [19, 44]
  • Литий [45]
  • Противосудорожные препараты Фенитоин (дилантин) [19]
  • Глюкокортикоиды [19, 46]
  • Ниацин (витамин B3) [47, 48]

Симптомы

При высоком уровне сахара в крови могут возникнуть следующие симптомы [19]:

  • Чувство сильной жажды
  • Частое мочеиспускание
  • Усталость
  • Затуманенное зрение
  • Медленно заживающие инфекции поговорите со своим врачом, чтобы выяснить, что вызывает высокий уровень глюкозы, и вылечите любые основные заболевания!

    Обсудите с врачом дополнительные изменения образа жизни, перечисленные ниже. Ни одна из этих стратегий никогда не должна использоваться вместо того, что рекомендует или прописывает ваш врач!

    Изменение образа жизни

    Если у вас избыточный вес, снижение веса улучшит способность вашего организма более эффективно использовать глюкозу и реагировать на нее, а также снизит риск развития диабета. Ожирение является фактором риска развития диабета номер один [15, 16, 18]! Потеря даже небольшого количества веса тела может быть очень полезной.

    Физическая активность — отличный способ контролировать уровень глюкозы в крови.Мышечная активность сжигает глюкозу для получения энергии и делает клетки более чувствительными к инсулину. Найдите что-нибудь интересное, чем вам будет нравиться заниматься регулярно (более 3 раз в неделю в течение более 30 минут) [49, 50, 51, 52, 53].

    Достаточно отдыхайте. Лишение сна и плохое качество сна снижают способность клеток реагировать на инсулин и со временем вызывают повышение уровня сахара в крови [33, 35].

    Управление стрессом. Стресс может повысить уровень сахара в крови за счет увеличения в организме таких гормонов, как кортизол и воспалительные молекулы [30, 54, 32, 55].

    Диета

    Здоровая диета поможет контролировать уровень сахара в крови!

    К полезным продуктам относятся овощи, фрукты, орехи, цельнозерновые продукты, рыба и оливковое масло [56, 57, 58] жирная пища. Самое главное, избегайте переедания вообще [59, 29].

    Регулярно питайтесь, особенно следите за тем, чтобы не пропускать завтрак. Начало дня без завтрака может привести к повышению уровня глюкозы в крови [60].

    С другой стороны, вы можете воздержаться от ночных закусок . Исследование показывает, что они связаны с ожирением и более высоким уровнем сахара в крови [61].

    Пейте много воды [62, 63]. Особенно полезно, если вы замените сладкие напитки водой.

    Исследования показывают, что умеренное употребление алкоголя (1 порция в день) может снизить уровень глюкозы в крови и предотвратить диабет и сердечные заболевания [64, 65, 66, 67]. Однако чрезмерное потребление оказывает негативное влияние и увеличивает риск развития диабета 2 типа.Обсудите потребление алкоголя с врачом.

    Пищевые добавки

    Поговорите со своим врачом о следующих пищевых продуктах и ​​пищевых добавках. Первоначальные исследования предполагают, что они могут помочь снизить уровень сахара в крови или могут быть полезны при преддиабете и диабете: 75, 76, 77]

  • Кофеин/Кофе [78, 79, 80, 81, 82, 83]
  • Хром [84, 85]
  • Корица [86, 87]
  • Пажитник [89, 89]
  • Клетчатка, такая как глюкоманнан или бета-глюканы [91, 92, 93, 94, 95, 96, 97, 98, 99]
  • Льняное семя [100, 101, 102, 103]
  • Чеснок [104, 105]
  • Зеленый чай [106, 107, 108]
  • Магний [109, 110]
  • Расторопша [111, 112]

Обратите внимание на недостаток следующих питательных веществ и поработайте с врачом над его исправлением, если он присутствует:

Низкий уровень сахара в крови натощак

Низкий уровень сахара в крови называется гипогликемией (гипо = низкий, гликемия = уровень сахара в крови). Это уровень сахара в крови ниже 70 мг/дл (3,9 ммоль/л) у диабетиков или около 55 мг/дл (3 ммоль/л) у здоровых людей.

Причины

Причины, показанные здесь, обычно связаны с пониженным уровнем сахара в крови. Посоветуйтесь со своим врачом или другим медицинским работником, чтобы поставить точный диагноз. Ваш врач будет интерпретировать этот тест, принимая во внимание вашу историю болезни, признаки и симптомы, а также результаты других тестов.

Гипогликемия или низкий уровень сахара в крови могут быть вызваны:

  • Диабетом 1 или 2 типа [120, 121]
  • Интенсивными физическими упражнениями или перетренированностью [122]
  • Недостаточным питанием/голоданием [123]
  • Чрезмерное употребление алкоголя [120, 121] 125]

  • Хирургия снижения веса (бариатрическая хирургия) [125]
  • Низкая активность щитовидной железы (гипотиреоз) [126]
  • Тяжелые инфекции или заболевания, включая печеночную, почечную или сердечную недостаточность [127, 125, 128, 24]
  • Надпочечниковая недостаточность (низкий уровень адреналина и кортизола) [129, 123]
  • Гипофизарная недостаточность (гипопитуитаризм) [130]
  • Опухоли поджелудочной железы [123, 131]
  • Некоторые редкие генетические нарушения или аутоиммунные состояния, влияющие на инсулин [132, 133, 125]

Гипогликемия часто вызывается лекарствами. Многие лекарства могут снижать уровень сахара в крови, в том числе:

  • Инсулин и противодиабетические средства, включая метформин [134, 125]
  • Аспирин [125]
  • Лекарства, используемые для лечения высокого кровяного давления, такие как бета-блокаторы [135]

Симптомы

симптомы низкого уровня сахара в крови включают [136, 137]:

  • потливость
  • Трепец
  • головные боли
  • беспокойство
  • размытое зрение

способов увеличения сахара в крови

самая важная вещь заключается в том, чтобы работать с врачом, чтобы выяснить, что вызывает низкий уровень сахара в крови, и лечить любые основные заболевания!

Обсудите дополнительные изменения образа жизни со своим врачом.Ни одна из этих стратегий никогда не должна использоваться вместо того, что рекомендует или прописывает ваш врач!

Образ жизни

Когда мы тренируемся, наши мышцы быстро сжигают глюкозу. Убедитесь, что вы хорошо поели заранее, чтобы предотвратить падение уровня сахара в крови.

Диета

Убедитесь, что вы питаетесь регулярно, в идеале часто небольшими порциями в течение дня, и что ваша диета хорошо сбалансирована. Выбирайте качественные углеводы и продукты, богатые пищевыми волокнами, витаминами и минералами и с низким содержанием добавленных сахаров, жиров и натрия [138].

Воздержитесь от употребления алкоголя, особенно натощак. Это может снизить уровень сахара в крови [124].

Добавки

Если вы склонны к снижению уровня сахара в крови из-за диабета, носите с собой добавку глюкозы и принимайте ее, когда почувствуете симптомы низкого уровня сахара в крови.

Генетика

Помимо питания и образа жизни, генетика также играет роль в уровне глюкозы в крови натощак и уровне HbA1c [139, 140]

Полногеномное ассоциативное исследование в семи мексиканских MTNR1B ген.Интересно, что этот ген кодирует рецептор мелатонина и помогает вам заснуть, но его чрезмерная активация может блокировать высвобождение инсулина и повышать риск диабета [141].

Существует две ассоциированные версии гена MTNR1B , одна из которых экспрессируется сильнее. Исследования показывают, что сверхэкспрессированная версия этого гена может быть фактором риска развития диабета и высокого уровня сахара в крови [141].

Дополнительное исследование обнаружило девять SNP, которые были связаны с уровнем глюкозы.Больше генов, влияющих на уровень глюкозы в крови натощак, — это G6PC2 и GCK [142, 143, 144].

Один вариант (rs1050828) в гене G6PD искусственно снижает уровень HbA1c, что делает этот тест менее чувствительным для выявления диабета [145].

Помните, что хотя гены и варианты генов могут оказывать некоторое влияние на уровень глюкозы, наибольшее влияние по-прежнему оказывает ваш образ жизни и выбор питания. Выбирай с умом!

Еда на вынос

Анализ уровня сахара в крови натощак также называется анализом уровня глюкозы натощак.Он измеряет уровень сахара после голодания в течение не менее 8 часов. Глюкоза является основным сахаром, который содержится в крови, и ее высокий уровень после голодания может указывать на диабет. Нормальный диапазон для здоровых людей составляет 70-125 мг/дл. Уровни в верхней части нормального диапазона (выше 100 мг/дл) сигнализируют о преддиабете, который часто приводит к диабету, если вы игнорируете его и откладываете изменение здорового образа жизни и диеты. Врачи обычно назначают анализ уровня сахара в крови натощак вместе с HbA1c, который может показать уровень сахара за последние пару месяцев.Как низкий, так и высокий уровень сахара в крови может быть опасным. Если у вас диабет, регулярно контролируйте уровень сахара (как с помощью лабораторных тестов, так и с помощью глюкометров), чтобы убедиться, что он стабилен.

что это? Пояснение к FBS

Основа любой постройки – грамотно созданный фундамент. Для обеспечения его прочности потребуются качественные строительные материалы. Фундаментный блок стены (это трактовка ФБС) поможет добиться успеха в создании надежной конструкции с небольшими затратами.

Что такое FBS?

Фундаментные блоки, созданные для формирования основания дома, прекрасно выдерживают нагрузки и дают уверенность в том, что дом будет крепким, несмотря на возможные ошибки в строительстве. Они сделаны из железобетона. Технические характеристики позволяют использовать ФБС как для возведения стен, так и для возведения крепи здания.

Они применяются в различных типах конструкций, и они очень популярны. ФБС отличаются долговечностью, прочностью.

Из чего они сделаны? Основой для фундаментных стеновых блоков (расшифровка ФБС) служит бетон – как легких, так и тяжелых марок. С помощью армирования они укрепляются, превращаясь в надежный строительный материал. Форма – параллелепипед.

Такие блоки хороши тем, что с их помощью фундамент и стены строить проще и быстрее, можно сократить финансовые траты. Они помогают правильно распределить нагрузку на фундамент здания и сделать стены крепкими, морозостойкими.

Особенности монтажа стен

Строительство зданий из блоков Сопровождается контролем каждого этапа работ. Самым ответственным моментом является технология выполнения соединений между компонентами. Их толщина не должна превышать 2 см, желательно, чтобы она была равна 1,5 см. Необходимо следить за их заполнением, правильностью создания деформационных швов. Блоки ФБС (расшифровка аббревиатуры — фундаментные блоки стены) нельзя укладывать так, чтобы швы между их первым рядом совпадали с пазом фундамента.

Нанесите на цементный раствор. В этом случае технология аналогична способу кладки кирпича. Чтобы агрегаты не отклонялись от вертикали в процессе работы, используйте отвес. Для правильного и ровного расположения при возведении первого и последующих этажей ориентируются на оси строительства. С помощью чертежа намечается расположение маяков: для возведения здания их сначала размещают в углах и на пересечениях стен будущего здания.После этого можно укладывать остальные ФБС.

Установка фундамента

В начале разбиваются оси под будущий фундамент здания. Подготовка траншей и траншей, их выравнивание. Если блоки уложены на песок, дополнительные работы не нужны. В случае работы с другим типом грунта требуется окуривание песком, более широким, чем сами блоки. Дно котлованов перед укладкой ФБС должно быть сухим – без снега и дождевой воды.

При сборке руководствуются чертежами.В начале работы укладывают маячные блоки, верх ровняют уровнем. Укрепляется цементом по принципу кирпичной кладки. Необходимо следить за качеством швов. Выравнивание стен подвала и стен из ПБС происходит по внутренней поверхности. Швы должны быть расшиты и заполнены. Фундамент прочный и быстро возводится.

Достоинства и недостатки

Прежде всего, скоростное возведение здания из фундаментных стеновых блоков (расшифровка ФБС).Материал прост в обработке, удобен. Блоки могут иметь монтажные петли, но производят ФБС без них.

Существуют разные классы прочности материала, в зависимости от бетона, из которого он изготовлен: В 7,5, 12,5, 15. Возможны варианты поверхностей блоков: под покраску, под плитку, невидимая при использовании, лицевая. ФБС – прочный материал, устойчивый к износу. Несложно предугадать, как он поведет себя в разных условиях. Крепление из ПБС в результате дает прочные толстые стенки, устойчивые к повреждениям.

К недостаткам можно отнести высокую стоимость материала. Кроме того, блоки ФБС обладают повышенной чувствительностью к перепадам температуры и влажности. Стоимость компенсируется тем, что материал дает результат быстро – здание возводится без задержек, без затруднений.

Фундаментные стеновые блоки (расшифровка ФБС) дают возможность в короткие сроки возвести надежное, прочное здание. Требуется лишь соблюдать основные правила работы с материалом и придерживаться технологии.

Одновременное связывание Guidance Cues NET1 и RGM блокирует внеклеточную сигнализацию NEO1

https://doi.org/10.1016/j.cell.2021.02.045Get права и контент опосредованное NEO1/DCC образование кластеров на клеточной поверхности

Рецептор NEO1 и его лиганды NET1 и RGM образуют суперкомплекс тример-из-тримеров Комплекс -NET1-RGM

Комплекс NEO1-NET1-RGM подавляет эффекты RGM и NET1 на миграцию нейронов

Резюме

Во время миграции или дифференцировки клеток рецепторы клеточной поверхности одновременно подвергаются воздействию различных лигандов. Однако часто неясно, как интегрируются эти внеклеточные сигналы. Неогенин (NEO1) действует как рецептор притяжения, когда связывается лиганд Netrin-1 (NET1), но он опосредует отталкивание через лиганды молекулы отталкивания (RGM). Здесь мы показываем, что интеграция сигнала происходит посредством образования тройного комплекса NEO1-NET1-RGM, который запускает реципрокное замалчивание нижестоящей передачи сигналов. Наши структуры NEO1-NET1-RGM обнаруживают суперсборку «тример из тримеров», которая существует в клеточной мембране.Формирование суперсборки приводит к ингибированию коллапса конуса роста, опосредованного RGMA-NEO1, и миграции нейронов, опосредованной RGMA- или NET1-NEO1, путем предотвращения образования сигнальных комплексов RGM-NEO1 и индуцированного NET1 кластеризации эктодомена NEO1. Эти результаты показывают, как одновременное связывание лигандов с противоположными функциями с одним рецептором приводит не к конкуренции за связывание, а к образованию суперкомплекса, который снижает их функциональные выходы.

Ключевые слова

Ключевые слова

Отражение сигналов

рецепторы сотовой поверхности

Регенерация аксовой связи

миграция ячейки

Netrin

NeOninin

Уведомление об отталкивающей молекула

Комплексная структура

Протеиновое белковое взаимодействие

Morphogen Privation

(0)

© 2021 Авторы.Опубликовано Elsevier Inc.

Рекомендованные статьи

Ссылки на статьи

Кальмодулин-контролируемое пространственное декодирование колебательных сигналов Ca2+ с помощью кальциневрина

Ряд изменений, в том числе несколько новых экспериментов, был включен в новую заявку, и мы считаем, что эти изменения полностью решают проблемы, поднятые рецензентами.

Рецензент 1:

1) Учитывая, что кальмодулин является лимитирующим, сверхэкспрессия репортеров, связывающих кальмодулин, вероятно, нарушит нормальный баланс.Как уровень CaNAR2 соотносится с эндогенным NFAT? Если CaNAR2 более сильно экспрессируется в ER, чем в цитозоле, это может объяснить разницу. Точно так же детектор конформации, CaNARi, может быть выражен на более низком уровне. Уровни экспрессии должны быть измерены и подтверждены как эквивалентные .

Рецензент поднимает важный вопрос, касающийся уровней экспрессии биосенсоров. К сожалению, после поиска литературы и консультаций со сторонними экспертами мы не смогли найти никаких конкретных данных об уровнях эндогенной экспрессии различных изоформ NFAT.Тем не менее, мы использовали очищенный YFP для калибровки подсчетов интенсивности, генерируемых нашим микроскопом, и на основе этой калибровки мы смогли оценить, что внутриклеточная концентрация цитоCaNAR2 в наших экспериментах колебалась от примерно 45 нМ до 4 мкМ. Важно отметить, что мы также обнаружили, что паттерны ответов, сообщаемые каждым субклеточно нацеленным вариантом CaNAR2, оставались стабильными в аналогичных диапазонах уровней экспрессии биосенсора, и раздел «Результаты» был обновлен, чтобы отразить этот вывод (см. рисунок 2 — приложение к рисунку 1). Точно так же мы не обнаружили значимой корреляции между уровнями экспрессии датчика конформации кальциневрина (CaNARi) или зонда Ca 2+ /CaM (BSCaM-2) и их наблюдаемыми изменениями отношения FRET. На основании этих данных мы делаем вывод, что экспрессия биосенсора не влияла на наши зарегистрированные наблюдения.

2) Следует исключить роль запасов кальция в ER, т.е. с использованием соответствующих лекарств .

Мы исследовали это с использованием субклеточно направленных версий GCaMP3, совместно трансфицированных вместе с диффундирующим RCaMP, и мы не обнаружили различий между локальной динамикой Ca 2+ в цитозоле, на поверхности ЭР или даже на плазматической мембране по сравнению с общей динамикой Ca 2+ динамика.Данные ER и цитозоля были добавлены в исправленную рукопись. Кроме того, хотя GCaMP3, нацеленный на ER, показал, что базальные уровни Ca 2+ вблизи ER дрейфуют вверх во время колебаний, этот базальный дрейф не влияет на ответ erCaNAR, что позволяет предположить, что запасы ER не играют значительной роли в дифференциальной активности кальциневрина. Мы обнаружили небольшую разницу в амплитуде Ca 2+ на поверхности ЭР по сравнению с цитозолем, и рукопись была обновлена, чтобы отразить это наблюдение; однако тот факт, что изменение только кальмодулина либо посредством сверхэкспрессии, либо путем ингибирования W7, может изменить паттерны активности кальцинейрина, указывает на более непосредственную роль кальмодулина.

3) Совместное колебание PKA и кальция не является неожиданным, но затрудняет четкую интерпретацию данных. Результаты были бы более убедительными, если бы активность PKA была буферизирована для предотвращения осцилляции 90–131 .

Как было предложено рецензентом, мы обновили рисунок 5 экспериментами, в которых активность PKA была зафиксирована на постоянном уровне. Для этого мы предварительно обрабатывали клетки пан-ингибитором фосфодиэстеразы IBMX, что приводило к максимальной активности PKA, а затем обрабатывали эти клетки повторными дозами KCl с последующим отмыванием.Мы не наблюдали различий в паттернах ответа CaNAR в этих условиях по сравнению с условиями, в которых активности PKA позволяли колебаться, т. Е. У CytoCaNAR2 был интегрирующий ответ, а у erCaNAR2 был колебательный ответ.

4) Эффект гиперэкспрессии кальмодулина должен дополняться ингибированием кальмодулина. Низкие дозы W7 или calmodulin siRNA должны вызывать колебания фосфорилирования NFAT в цитозоле, а также ER .

Благодарим рецензента за предложение провести этот эксперимент.Мы действительно обнаружили, что предварительная обработка клеток MIN6 субмаксимальной дозой (20 мкМ) W7 с последующим повторным введением доз KCl вызывает полностью колебательные ответы цитоCaNAR2. Эти новые данные были добавлены к рисунку 9 в исправленной рукописи.

5) Из модели не ясно, почему датчик конформации кальциневрина колеблется в ЭР. Величина колебаний FRET аналогична в ЭР и цитозоле на показанных кривых. Если бы кальмодулин был лимитирующим, можно было бы ожидать меньшей величины.Объяснение неясно и требует разрешения .

Учитывая, что активация и, следовательно, конформация кальциневрина строго контролируется цитозольным повышением Ca 2+ , ожидается, что колебания Ca 2+ будут индуцировать осцилляторную активацию кальциневрина, даже если активируется меньше кальциневрина. Кроме того, поскольку ответ FRET от этого сенсора невелик, он не может достоверно сообщить о различиях в амплитуде активации кальциневрина.Тем не менее, основываясь на этом комментарии, мы более тщательно сравнили амплитуды ответов и обнаружили, что ответы от митохондриального и ER-мишенного CaNARi были фактически в среднем меньше, чем ответы от цитозольной и плазматической мембраны CaNARi. Эти данные теперь обобщены на рисунке 7B пересмотренной рукописи. Хотя разница не была статистически значимой, наблюдаемая тенденция подтверждает нашу модель, и мы благодарим рецензента за то, что он побудил более внимательно изучить наши данные.

Рецензент 2:

1) Я не понимаю, почему митохондриальная область отличается от ответа цитозоля .

Мы решили сосредоточиться на различной динамике активности между поверхностью ЭР и цитозолем. Динамика активности на внешней митохондриальной мембране была аналогична той, что наблюдалась в ER, и основные механизмы будут изучены в будущих исследованиях.

2) Мне также интересно, отличаются ли колебания кальция вблизи плазмы или мембраны ER, соответственно, таким же образом, как ответы кальцинейрина. Сильная поддержка исходит от экспериментов, в которых CaM сверхэкспрессирован, а сенсор, расположенный в ER, имитирует расположение цитозоля и плазматической мембраны.Чего не хватает, так это альтернативного эксперимента, в котором кальциневрин должен быть заблокирован скромными уровнями W-7. Это должно привести к совершенным колебаниям кальцинейрина повсюду .

Различия в паттернах колебаний также могут быть обусловлены активностью соответствующих мембран, такой как приток кальция вблизи плазматической мембраны или более эффективное поглощение кальция SERCA вблизи ER. Эти возможности не исследованы и не обсуждаются .

Как упоминалось выше в ответе рецензенту 1, мы не наблюдали различий между колебаниями Ca 2+ в цитозоле, на поверхности ЭР или на плазматической мембране (измеренные с использованием субклеточно нацеленного GCaMP3) и глобальными колебаниями Ca 2+ колебания (одновременно измеренные с использованием диффузионного RCaMP), предполагая, что локальные сигналы Ca 2+ не являются определяющим фактором для дифференциальных ответов кальциневрина. Кривые GCaMP/RCaMP для цитозоля и ER были добавлены в исправленную рукопись (рис. 8).

Благодарим рецензента за предложение провести этот эксперимент. Как упоминалось выше, мы действительно обнаружили, что предварительная обработка клеток MIN6 субмаксимальной дозой (20 мкМ) W7 с последующим неоднократным добавлением и вымыванием KCl вызывает полностью колебательные ответы отcytoCaNAR2. Эти новые данные были добавлены к рисунку 9 в исправленной рукописи.

3) Точно так же эффекты ингибиторов PKA и PKC могут сильно влиять на кальциевые каналы, включая рецептор IP3, и поэтому могут изменять пороговый уровень кальция, необходимый для успешных колебаний.Гипотеза о том, что имеется утечка кальция вблизи ER, является слабым объяснением устойчивого увеличения активности кальцинейрина после Goe6983 и H89 .

Рецензент прав в том, что ингибирование PKA или PKC может изменить поведение каналов Ca 2+ . Например, было показано, что PKA стимулирует активность как VGCC L-типа, так и рецептора IP3; таким образом, ингибирование PKA должно приводить к уменьшению притока Ca 2+ , что фактически и наблюдается на рисунке 3A. И наоборот, было показано, что PKC ингибирует оба этих канала, и мы также видим на рисунке 3C, что ингибирование PKC приводит к увеличению уровней Ca 2+ и, потенциально, к увеличению активности кальциневрина (см. ответы рецензенту 1 выше). В то время как увеличение активности кальциневрина после ингибирования PKC явно связано с повышенным содержанием Ca 2+ , мы приписали повышение активности кальциневрина после ингибирования PKA утечке Ca 2+ из-за снижения уровня Ca 2+ и, вероятно, снижение IP3R-опосредованного высвобождения Ca 2+ , хотя последнее все еще может иметь эффект.

4) Представленная модель основана на том факте, что Ca/CaM активирует кальциневрин. Однако ранее было показано, что активации не-кальций-зависимых фосфатаз, таких как PP1, достаточно, чтобы индуцировать колебания кальция в отсутствие деполяризации, вероятно, за счет изменения уровня фосфорилирования рецептора IP3 (Reither et al., 2013). Активация кальциневрина также вызывает сигналы кальция? Если бы это было так, модель должна была бы быть намного сложнее .

Было показано, что

кальциневрин взаимодействует с каналами высвобождения ER Ca 2+ , такими как рецептор IP3, и потенциально может модулировать их активность, хотя это остается несколько спорным.Кроме того, известно, что кальциневрин ингибирует приток через каналы Ca 2+ плазматической мембраны. Следовательно, более вероятно, что кальциневрин модулирует существующие сигналы Ca 2+ , а не индуцирует их как таковые. Возможно, что кальцинейрин оказывает и другие эффекты, стимулируя приток Ca 2+ ; однако в настоящее время нет убедительных доказательств, которые заставили бы нас двигаться в этом направлении.

5) Я доверяю утверждению, что CaM может быть недостаточным в некоторых клетках, но насколько его много в клетках Min6? По крайней мере, оценка из транскриптома должна была быть предоставлена, поскольку вывод о субклеточных различиях в Ca / CaM основан на предположении о дефиците.Кроме того, если концентрация CaM действительно находилась в диапазоне менее 100 нМ, то сверхэкспрессия связывающего CaM белка (обычно в микромолярном диапазоне) определенно будет буферизировать CaM вблизи его местоположения на мембране ER. Есть шанс, что либо достаточно CaM, либо датчик выдает артефакт. Боюсь, авторы не могут выиграть на этом. Был ли BSCaM-2 также прикреплен к плазматической мембране и использовался для определения там концентрации CaM? В заключение, хотя это и очень интересно, слишком много открытых вопросов и слишком много экспериментов необходимо провести, чтобы принять эту статью .

Мы не использовали этот основанный на BCaM-2 подход для определения концентрации свободного Ca 2+ /CaM; скорее, нашей целью было просто сравнить относительные уровни Ca 2+ /CaM в разных компартментах, как это было сделано ранее с использованием этих зондов (Teruel et al., 2000). Насколько нам известно, этот тип информации трудно получить с помощью других методов. BCaM-2, нацеленный на цитозоль и плазматическую мембрану, продемонстрировал идентичные ответы (80,61 ± 0,03% против 79,15 ± 0,04% изменения отношения FRET), тогда как ответ на поверхности ЭР ниже (50.74 ± 0,03%), предполагая, что уровень свободного Ca 2+ /CaM ниже в этом компартменте. В экспериментах с BSCaM-2 не отслеживались процессы передачи сигналов ниже по течению, тем самым ограничивая потенциал буферных эффектов, и мы также не обнаружили корреляции между экспрессией зонда и ответом FRET в широком диапазоне уровней экспрессии, которую мы ожидали бы увидеть, если бы уровни биосенсора, влияющие на результаты. Кроме того, избыточная экспрессия CaM или ингибирование CaM с использованием W7 явно модулировали ответы ER и цитозольного CaNAR соответственно, не говоря уже о том факте, что избыточная экспрессия CaM восстанавливала ответ BSCaM-2 на поверхности ER (70.03 ± 0,03%). Эти наблюдения, в частности, убедительно свидетельствуют о том, что уровни свободного Ca 2+ /CaM ограничены вблизи поверхности ER, что приводит к более слабой активации кальциневрина в этом месте. Сходные наблюдения были сделаны Teruel et al., которые сообщили о меньшем увеличении уровней свободного ядра Ca 2+ /CaM по сравнению с цитозолем в ответ на переходные процессы Ca 2+ (Teruel et al.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

*

*

*